[_ Old Earth _] Again, evolutionists contradict...

[Heidi]

Here are some more contradictions by evolutionists:

1) the idea that genes for blue eyes just appears in apes who have brown eyes

2) The gene for speech just appears in apes who can't talk

3) The gene for cognition just appears in apes who can't think

4) The ability for spirituality just appears in apes who can't understand God.

5) The gene for walking on 2 legs just appears in apes who walk on 4 legs.

6) The gene for blond hair just appears in apes who have dark hair.

Evolutionists claim that genes simply change into other genes without breeding with animals who have these genes. Of course this contradicts the way each species is propogated, but contradicting reality is the basic premise on which evolution was built. They don't realize that mutations are aberrations of existing cells, not making up new ones. When people buy into their theories, they are also believing that mating and breeding are of no importance in passing along genes. And since they believe that genes turn into other genes on their own, then they don't see why human offspring resemlbe their parents. But at the same time, scientists also claim that one's ancestry has to have had certain genes in order to pass them along to their offsrping. So which is it? :o

So I can see why evolutionists have such a hard time explaining their theoriesand why their thoery is so long and ever-changing because of all the contradictions they make with each new statement. This again, is what happens when people lie. They have to tell a 2nd lie to explain the 1st, then a 3rd and 4th until they've forgotten what their first statement was! That's why lies are always convoluted whereas the truth is simple and never changes or contradicts itself. Evolutionists first have to understand that before they can even being to discern between truth and fiction. :wink:

 

[cubedbee]

Here are some more contradictions by evolutionists:

1) the idea that genes for blue eyes just appears in apes who have brown eyes

The brown of eyes comes from the pigment called melanin in your eyes. If this pigment is not present, then the eyes are blue. So a very simple mutation to the gene controlling the production of pigment, one which causes a defect, a loss of information, a mutation that all educated YECs will readily admit happen all the time, can lead to blue eyes in a brown eyed population. Please, do some research before you post.

2) The gene for speech just appears in apes who can't talk

There is no gene for speech. The differences between our throat and mouth and those of other primates come from a variety of genes, not a single mutation.

3) The gene for cognition just appears in apes who can't think

What gives you the impression apes can think? You know that chimps learn sign language right, that they can use language to describe things at a level of a 4 or 5 year old child, certainly thinking creatures. Once again, this is a claim that I've never heard from anyone, creationist or evolutionist, before I first read your post. Where do you come up with this stuff?

4) The ability for spirituality just appears in apes who can't understand God.

Spirituality isn't a physical thing caused by genetics. Not pertinent ot this subject.

5) The gene for walking on 2 legs just appears in apes who walk on 4 legs.

Other primates don't have 4 legs, they have 2 legs and 2 arms. They walk on their legs usually with the aid of their hands on the ground, but they are all capable of walking on two legs alone. The only mutation needed to walk on two legs all the time is the mutation that shortened the arm.

6) The gene for blond hair just appears in apes who have dark hair.

See the comment on eyes. Mutations happen, and this is a trivial one involving the production of a pigment. Maybe you should study some science before making these claims?

Evolutionists claim that genes simply change into other genes without breeding with animals who have these genes.

Genes mutate from a variety of factors. Mutatated sex genes create new genes in a population. This is a fact.

Of course this contradicts the way each species is propogated, but contradicting reality is the basic premise on which evolution was built.

Nope, you just don't understand evolution at all.

They don't realize that mutations are aberrations of existing cells, not making up new ones.

You clearly don't understand what a mutation is, because it is genes, not cells, that mutate. So, do you know anything about the science you are slandering?

When people buy into their theories, they are also believing that mating and breeding are of no importance in passing along genes.

Nope, that's ridiculous. Mating passes on mutated genes, introducing new genes into the population. Please, pick up a middle school biology textbook and read the chapter on evolution. It's really not that complex of a theory, I'm sure you can pick up a basic understanding if you make the effort.

And since they believe that genes turn into other genes on their own, then they don't see why human offspring resemlbe their parents. But at the same time, scientists also claim that one's ancestry has to have had certain genes in order to pass them along to their offsrping. So which is it? :o

Umm, your second question doesn't make too much sense, but the answer is probably it's both, and you just don't understand one or either of the things you are claiming contradict one another.

So I can see why evolutionists have such a hard time explaining their theoriesand why their thoery is so long and ever-changing because of all the contradictions they make with each new statement.

Yeah, none of this is really true. But it's easy to lie about things you don't understand, isn't it.

 

[jwu]

5) The gene for walking on 2 legs just appears in apes who walk on 4 legs.

Let me introduce you to Oliver, the bipedal chimp:

http://en.wikipedia.org/wiki/Oliver_the_chimp

 

[reznwerks]

Here are some more contradictions by evolutionists:

1) the idea that genes for blue eyes just appears in apes who have brown eyes
Maybe now you will understand that man is a species unto himself. He is different than apes that is why man has blue eyes and apes don't.

2) The gene for speech just appears in apes who can't talk
Same answer as above but not to discount the fact the apes communicate with each other and now communicate with man via a keyboard.

3) The gene for cognition just appears in apes who can't think
Our cognitivive ability is greater than ape but apes do think and use tools.

4) The ability for spirituality just appears in apes who can't understand God.
This is the ability to use imagination. Apes don't appear to have this so again I refere you to answere #1.

5) The gene for walking on 2 legs just appears in apes who walk on 4 legs.
Check the post on Oliver and again check answer #1

6) The gene for blond hair just appears in apes who have dark hair.
Check answer #1

Evolutionists claim that genes simply change into other genes without breeding with animals who have these genes. Of course this contradicts the way each species is propogated, but contradicting reality is the basic premise on which evolution was built.
Please show the source for your inaccuracies.


They don't realize that mutations are aberrations of existing cells, not making up new ones. When people buy into their theories, they are also believing that mating and breeding are of no importance in passing along genes. And since they believe that genes turn into other genes on their own, then they don't see why human offspring resemlbe their parents. But at the same time, scientists also claim that one's ancestry has to have had certain genes in order to pass them along to their offsrping. So which is it? :o
Please cite your sources for your inaccuracies.

So I can see why evolutionists have such a hard time explaining their theoriesand why their thoery is so long and ever-changing because of all the contradictions they make with each new statement.
I haven't heard any evolutists have any problems getting their point across. Could you cite your sources?

This again, is what happens when people lie. They have to tell a 2nd lie to explain the 1st, then a 3rd and 4th until they've forgotten what their first statement was! That's why lies are always convoluted whereas the truth is simple and never changes or contradicts itself. Evolutionists first have to understand that before they can even being to discern between truth and fiction. :wink:
Can you show the source for your claims?

 

[pasta911]

Just look at my Signature

 

[Heidi]

5) The gene for walking on 2 legs just appears in apes who walk on 4 legs.

Let me introduce you to Oliver, the bipedal chimp:

http://en.wikipedia.org/wiki/Oliver_the_chimp

So if this creature existed, then why haven't they used his as evidence of "Bigfoot"? Also, why was he the only chimp who stands on 2 legs? I thought that evolutonists claim that populations change, not just one offspring. So which is it? Are they going to change their story again or make up a new one instead? :o

 

[cubedbee]

5) The gene for walking on 2 legs just appears in apes who walk on 4 legs.

Let me introduce you to Oliver, the bipedal chimp:

http://en.wikipedia.org/wiki/Oliver_the_chimp

So if this creature existed, then why haven't they used his as evidence of "Bigfoot"? Also, why was he the only chimp who stands on 2 legs? I thought that evolutonists claim that populations change, not just one offspring. So which is it? Are they going to change their story again or make up a new one instead? :o

One story, hasn't changed, has stayed the same. You just don't understand that story or know what it says. It's out there for you to find out if you want. Or you could just keep telling lies about evolution. You're choice, I'm sure you'll make the Christ-like decision.

 

[Heidi]

So again, what is the story? :o For the umpteenth time, do evolutionists claim that ape genes turned into human genes on their own without breeding with a human? Yes or no.

 

[jwu]

So if this creature existed, then why haven't they used his as evidence of "Bigfoot"?

Why would they? How does this even matter? Do you deny that Oliver existed?

Also, why was he the only chimp who stands on 2 legs?

Because he didn't have children?

Either way, your asserted contradiction #5 is proven wrong, unless you deny Oliver's existence. Do you retract it?

I thought that evolutonists claim that populations change, not just one offspring. So which is it? Are they going to change their story again or make up a new one instead?

Populations do evolve - but it always begins with a mutation in an individual. Over the course of several generations this mutation then spreads through the population and gets fixed, if it's not selected against.

So again, what is the story? For the umpteenth time, do evolutionists claim that ape genes turned into human genes on their own without breeding with a human? Yes or no.

That question makes no sense as there are no different types of genes in the way as you distinguish them. There are just genes. Our genes have changed a bit in the past millions of years, and now the result that they produce is a homo sapiens.

The genes of humans and non human primates are about as similar as these two samples:

GACTGCATCGCCTAAGCTCGATACGCGCTACGAATAGCGATCGCATACGCATA
GACTGCATCGCCTAAGCTCGATACGCGCTACGAATAGCGCTCGCATACGCATA

 

[reznwerks]

bigfoot

5) The gene for walking on 2 legs just appears in apes who walk on 4 legs.

Let me introduce you to Oliver, the bipedal chimp:

http://en.wikipedia.org/wiki/Oliver_the_chimp

So if this creature existed, then why haven't they used his as evidence of "Bigfoot"?
He doesn't fit the description of bigfoot.


Also, why was he the only chimp who stands on 2 legs? I thought that evolutonists claim that populations change, not just one offspring. So which is it? Are they going to change their story again or make up a new one instead? :o
[color=blue[ No one is changing any story. Oliver is a mystery and a specimen that harbours many traits of humans. Whether Oliver is somehow a crossbreed and interbred with a human no one knows for sure. However Oliver is not the figment of anyones imagination.[/color]