[_ Old Earth _] Evolution - Part 2

[Barbarian]

Give me just 1 example of something more complicated than DNA.

Nervious system of almost any vertebrate. Immune system of mammals. Internet. Aircraft carrier. Termite colony.

 

[Vaccine]

Give me just 1 example of something more complicated than DNA.

Nervious system of almost any vertebrate. Immune system of mammals. Internet. Aircraft carrier. Termite colony.

Since the nervous system, immune system and termites are a product of DNA and don't function without DNA I they don't count, the sum can't be greater than the whole.

I would say an aircraft carrier is more powerful, but not more complicated. DNA is fully automated, a carrier isn't. DNA is self repairing, a carrier isn't. DNA is self replicating, a carrier isn't. DNA has been around a lot longer than any carrier, and 200 years from now when that carrier is a bucket of rust DNA will still be around.

Well the internet is actually a tough one. True the internet has more information, but is it really more complex? Physically it's just a bunch of wires, routers, and computers. None of those can repair themselves or replicate themselves. The internet can repair and replicate its information same as DNA. The internet is mostly automated, but not 100%. The internet makes more information. DNA makes every living thing on the planet.

without DNA the internet, a carrier, a termite colony, the nervous system or immune system would not exist.

 

[Adam]

The base question that I see arise stems from the attempt to understand where the ability to form code comes from; what purely natural cause is there?

I'm not sure what you mean by "ability to form code."


We think of code as needing translation, but here we actually are using it to mean manifestation; a physical structure governs the order in a process.

 

[Vaccine]

Definition of CODE

1
: a systematic statement of a body of law; especially: one given statutory force

2
: a system of principles or rules <moral code>

3
a: a system of signals or symbols for communication
b: a system of symbols (as letters or numbers) used to represent assigned and often secret meanings

4
: genetic code

5
: a set of instructions for a computer
— code·less \-ləs\adjective



Origin of CODE

Middle English, from Middle French, from Latin caudex, codex trunk of a tree, document formed originally from wooden tabletsFirst Known Use: 14th century


Related to CODE

Synonymscanon, constitution, decalogue, lawRelated Wordsdiscipline, establishment; common law, legislation
more


2code

verb
cod·edcod·ing
Definition of CODE

transitive verb
: to put in or into the form or symbols of a code

intransitive verb
: to specify the genetic code <a gene that codes for a protein>
— cod·able \ˈkō-də-bəl\adjective


Examples of CODE

• The general sent a coded message.
• Each product has been coded.

First Known Use of CODE

1815

code

noun (Concise Encyclopedia)
System of symbols and rules used for expressing information according to an unvarying rule for replacing a piece of information from one system, such as a letter, word, or phrase, with an arbitrarily selected equivalent in another system. Substitution ciphers are similar to codes except that the rule for replacing the information is known only to the transmitter and the intended recipient of the information. Binary code and other machine languages used in digital computers are examples of codes. Elaborate commercial codes were developed during the early 20th century (see Jean M.E. Baudot, Samuel F. B. Morse). In recent years more advanced codes have been developed to accommodate computer data and satellite communications. See also ASCII, cryptography.

http://www.merriam-webster.com/dictionary/code



This wasn't meant to be sarcastic, but rather just trying to keep the discussion moving forward so we don't get hung up on a defining a term.

In computer science, a program "generates" machine code which is understood by the hardware.
DNA "generates" genetic code which is understood by RNA.
BASIC is a set of instructions for a computer (machine).
DNA is a set of instructions for RNA (machine). RNA is a machine in that it consists of one or more parts and uses energy to achieve a particular goal.
BASIC has a syntax, DNA has a syntax.
Computer code is binary, DNA is quaternary.

BASIC and DNA are both examples of an artificial language.

 

[Milk-Drops]

You know people are reaching when they have to play semantics to make their point. Look, DNA is not the same as computer code unless you use the most kindergarten/ vague definition you can get. When you get away from that and actually try to directly compare DNA to computer code, you end up with problems, like how DNA is a combination of proteins where computer code is math algorithms and symbols.

Also, not that you are stretching this into an argument that RNA is a machine I'm done. At this point the connection has been made so vague that anything can be considered a machine or code.

 

[Barbarian]

Since the nervous system, immune system and termites are a product of DNA and don't function without DNA I they don't count, the sum can't be greater than the whole.

But it's not a sum. It's just something far more complex than DNA.

I would say an aircraft carrier is more powerful, but not more complicated.

But it is. There would be far more information needed to code for an aircraft carrier, than to code for most genomes.

DNA is fully automated, a carrier isn't.

Automation is not a measure of complexity. We have about 30,000 genes. An aircraft carrier has many millions of "genes."

DNA is self repairing, a carrier isn't. DNA is self replicating, a carrier isn't.

Neither of these are measures of complexity, either.

DNA has been around a lot longer than any carrier, and 200 years from now when that carrier is a bucket of rust DNA will still be around.

Longetivity isn't a measure of complexity.

Well the internet is actually a tough one. True the internet has more information, but is it really more complex?

Yes.

Physically it's just a bunch of wires, routers, and computers.

No, that's just a small part of it. There is also software and the movement of information as well. Much more complicated than DNA.

None of those can repair themselves or replicate themselves.

See above.

The internet makes more information. DNA makes every living thing on the planet.

Not a measure of complexity.

 

[Barbarian]

DNA is a set of instructions for RNA (machine). RNA is a machine in that it consists of one or more parts and uses energy to achieve a particular goal.

But unlike artificial instructions, it is evolved to produce enough errors to maintain variability in a population so that it can evolve as the population changes.

BASIC and DNA are both examples of an artificial language.

Here, you've assumed what you proposed to prove. No artificial languages can do what an evolved one can do. There are evolved computer languages, and they are much more like DNA than any artificial one.

The real convincer is the fact that evolutionary processes work better than design, for complex problems:

Let Darwinism loose in an electronics lab and just watch what it creates. A lean, mean machine that nobody understands. Clive Davidson
reports

"GO!" barks the researcher into the microphone. The oscilloscope in front of him displays a steady green line across the top of its screen. "Stop!" he says and the line immediately drops to the bottom.

Between the microphone and the oscilloscope is an electronic circuit that discriminates between the two words. It puts out 5 volts when it hears "go" and cuts off the signal when it hears "stop".

It is unremarkable that a microprocessor can perform such a task--except in this case. Even though the circuit consists of only a small number of basic components, the researcher, Adrian Thompson, does not know how it works. He can't ask the designer because there wasn't one. Instead, the circuit evolved from a "primordial soup" of
silicon components guided by the principles of genetic variation and survival of the fittest...What would happen, Thompson asked, if it were possible to strip away
the digital constraints and apply evolution directly to the hardware? Would evolution be able to exploit all the electronic properties of silicon components in the same way that it has exploited the biochemical structures of the organic world?

"I wanted to see what happens if you let evolution break out of the constraints that humans have," says Thompson. "If you give it some hardware, does it do new things?" These questions could only be answered if a way were found to combine the "wet" processes of biological evolution with the "dry" world of silicon chips. Thompson
found the solution in a field-programmable gate array (FPGA)...That repertoire turns out to be more intriguing than Thompson could have imagined. Although the configuration program specified tasks for all 100 cells, it transpired that only 32 were essential to the circuit's operation. Thompson could bypass the other cells without affecting it. A further five cells appeared to serve no logical purpose at all--there was no route of connections by which they could influence the output. And yet if he disconnected them, the circuit
stopped working.

It appears that evolution made use of some physical property of these cells--possibly a capacitive effect or electromagnetic inductance--to influence a signal passing nearby. Somehow, it seized on this subtle effect and incorporated it into the solution.
http://www.netscrap.com/netscrap_detail.cfm?scrap_id=73

This is why engineers have turned to evolution for very complex problems that defy design. Genetic algorithm mimic evolution to solve those problems. The only problem is, we often don't know why the solution works.

It turns out, God knew best, after all.

 

[Adam]

Anyone ever read "Cat's Cradle"?

In it he discusses a concept called Ice-nine in which a scientist manipulates a water molecule structure which changes the way environmental factors influence this specific type of water (the melting/boiling points are altered) because of the new way that these molecules "stack."

This is only vaguely relevant but what we are dealing with is like this concept, but only with sugar molecules. I don't think DNA is a set of "instructions" any more than a river is a set of instructions. There is a natural course that water follows, but the course is altered minutely as the river flows.

There are a set of physical rules responsible for this, but not stored information.

 

[Vaccine]

But it's not a sum. It's just something far more complex than DNA.



But it is. There would be far more information needed to code for an aircraft carrier, than to code for most genomes.



Automation is not a measure of complexity. We have about 30,000 genes. An aircraft carrier has many millions of "genes."

DNA is self repairing, a carrier isn't. DNA is self replicating, a carrier isn't.

Neither of these are measures of complexity, either.

DNA has been around a lot longer than any carrier, and 200 years from now when that carrier is a bucket of rust DNA will still be around.

Longetivity isn't a measure of complexity.

Well the internet is actually a tough one. True the internet has more information, but is it really more complex?

Yes.

Physically it's just a bunch of wires, routers, and computers.

No, that's just a small part of it. There is also software and the movement of information as well. Much more complicated than DNA.

None of those can repair themselves or replicate themselves.

See above.

The internet makes more information. DNA makes every living thing on the planet.

Not a measure of complexity.

My original post was making the point God's creation is more complex than anything man made.

 

[Vaccine]

But unlike artificial instructions, it is evolved to produce enough errors to maintain variability in a population so that it can evolve as the population changes.

A program that actually improves with time, that actually adds features over time. I don't agree with the term errors, I think design is more appropriate. But yes, absolutely amazing what God can do.

BASIC and DNA are both examples of an artificial language.

Here, you've assumed what you proposed to prove.

I made observations, noted the similarities, and came to a conclusion.

No artificial languages can do what an evolved one can do. There are evolved computer languages, and they are much more like DNA than any artificial one.

A programmer assumes a program can evolve. A programmer makes a program that can evolve.
So a program evolves. It was an intentional DESIGNED aspect of the program.

The real convincer is the fact that evolutionary processes work better than design,

See above.

Let Darwinism loose in an electronics lab and just watch what it creates.

I see why people worship Darwin as a god now.

It is unremarkable that a microprocessor can perform such a task--except in this case. Even though the circuit consists of only a small number of basic components, the researcher, Adrian Thompson, does not know how it works. He can't ask the designer because there wasn't one. Instead, the circuit evolved from a "primordial soup" of
silicon components guided by the principles of genetic variation and survival of the fittest...What would happen, Thompson asked, if it were possible to strip away
the digital constraints and apply evolution directly to the hardware? Would evolution be able to exploit all the electronic properties of silicon components in the same way that it has exploited the biochemical structures of the organic world?

Let me see if I understand this, Thompson starts with a “designed” primordial soup, from a bunch of “designed” basic silicon components. Plugs it into a “designed” power source, plugs in a “designed” microphone, plugs in a “designed” oscilloscope, and somehow this proves “evolution” is better than design?

"I wanted to see what happens if you let evolution break out of the constraints that humans have," says Thompson.

To truly break out he would have had to start with things not designed, which he didn't.

"If you give it some hardware, does it do new things?" These questions could only be answered if a way were found to combine the "wet" processes of biological evolution with the "dry" world of silicon chips. Thompson
found the solution in a field-programmable gate array (FPGA)...That repertoire turns out to be more intriguing than Thompson could have imagined. Although the configuration program specified tasks for all 100 cells, it transpired that only 32 were essential to the circuit's operation. Thompson could bypass the other cells without affecting it. A further five cells appeared to serve no logical purpose at all--there was no route of connections by which they could influence the output. And yet if he disconnected them, the circuit
stopped working.

It appears that evolution made use of some physical property of these cells--possibly a capacitive effect or electromagnetic inductance--to influence a signal passing nearby. Somehow, it seized on this subtle effect and incorporated it into the solution.

http://www.netscrap.com/netscrap_detail.cfm?scrap_id=73

This is why engineers have turned to evolution for very complex problems that defy design. Genetic algorithm mimic evolution to solve those problems. The only problem is, we often don't know why the solution works.

Engineers turn to God's design.










Amen.

 

[Adam]

A program that actually improves with time, that actually adds features over time. I don't agree with the term errors, I think design is more appropriate

Every mutation is an "error." Evolution is the advancement of errors that prove to enhance the success of an organism within a population. If there is an inherent benefit because of an error, the liklihood of mating increases. Following, then, the liklihood of the error spreading through a population increases.

Whether or not the error (gene deletion) proves to be beneficial in this child will highly influence his chance of securing a mate. Only time will determinine that. But be sure to consider that " a program that improves/adds features" also necessitates variation that is unsuccessful, recessive, injurious, depletive.


Neither "design" or "error" are appropriate terms in an absolute sense.

 

[Barbarian]

My original post was making the point God's creation is more complex than anything man made.

That's true; our entire universe is just a part of God's creation.

 

[Barbarian]

A program that actually improves with time, that actually adds features over time. I don't agree with the term errors, I think design is more appropriate. But yes, absolutely amazing what God can do.

In the sense of creating a universe in which things can evolve from simpler things, yes.

BASIC and DNA are both examples of an artificial language.

Barbarian observes:
Here, you've assumed what you proposed to prove.

I made observations, noted the similarities, and came to a conclusion.

One is demonstrably artificial. One is demonstrably natural. If it was designed by God, it would be the same in all organisms. But it's not. And the small differences sort out according to taxa, so the evidence shows that evolved, too. If it was designed, the "designer" isn't so good.

Barbarian observes:
No artificial languages can do what an evolved one can do. There are evolved computer languages, and they are much more like DNA than any artificial one.

A programmer assumes a program can evolve. A programmer makes a program that can evolve.
So a program evolves. It was an intentional DESIGNED aspect of the program.

Yes. Inferior creatures can only design. God has no need of figuring things out. He creates.

Barbarian observes:
The real convincer is the fact that evolutionary processes work better than design,

See above.

As you see, God knew best. He could have designed things, like a human or a chimp building tools. But he had no need of it, and evolution works better.

Quote Originally Posted by Barbarian View Post
Let Darwinism loose in an electronics lab and just watch what it creates.

I see why people worship Darwin as a god now.

Sounds doubtful. But Christians acknowledge that God's greatness is shown in the way He created things. We can only build inferior copies of evolution in genetic algorithms or circuits that use natural selection to find efficient solutions. God created those things, with no need of design at all.

Quote Originally Posted by Barbarian View Post
It is unremarkable that a microprocessor can perform such a task--except in this case. Even though the circuit consists of only a small number of basic components, the researcher, Adrian Thompson, does not know how it works. He can't ask the designer because there wasn't one. Instead, the circuit evolved from a "primordial soup" of
silicon components guided by the principles of genetic variation and survival of the fittest...What would happen, Thompson asked, if it were possible to strip away
the digital constraints and apply evolution directly to the hardware? Would evolution be able to exploit all the electronic properties of silicon components in the same way that it has exploited the biochemical structures of the organic world?

Let me see if I understand this, Thompson starts with a “designed†primordial soup

Nope. Just components capable of changing, and a way of introducing natural selection into the process.

from a bunch of “designed†basic silicon components. Plugs it into a “designed†power source, plugs in a “designed†microphone, plugs in a “designed†oscilloscope, and somehow this proves “evolution†is better than design?

Yep. As you see, by producing an imitation of what goes on in nature, he set up the conditions for evolution to produce a solution more efficient and effective than anything a human can design. It even found ways of making the system work better that humans don't yet understand. This is created into nature, not something the engineer designed. It's just something we discovered about the way the universe works.

"I wanted to see what happens if you let evolution break out of the constraints that humans have," says Thompson.

To truly break out he would have had to start with things not designed, which he didn't.

But he did. He just found a way to let it work the way nature does.

"If you give it some hardware, does it do new things?" These questions could only be answered if a way were found to combine the "wet" processes of biological evolution with the "dry" world of silicon chips. Thompson
found the solution in a field-programmable gate array (FPGA)...That repertoire turns out to be more intriguing than Thompson could have imagined. Although the configuration program specified tasks for all 100 cells, it transpired that only 32 were essential to the circuit's operation. Thompson could bypass the other cells without affecting it. A further five cells appeared to serve no logical purpose at all--there was no route of connections by which they could influence the output. And yet if he disconnected them, the circuit
stopped working.

It appears that evolution made use of some physical property of these cells--possibly a capacitive effect or electromagnetic inductance--to influence a signal passing nearby. Somehow, it seized on this subtle effect and incorporated it into the solution.

Engineers turn to God's design.

It is disrespectful to suggest God is limited. He is the Creator. By demoting him to a "designer" (the guys who invented ID say God could just be a "space alien") one denies His omnipotence.

Why would they say He could just be another creature? Because design is not an attribute of an omnipotent God. It is the necessary action of a limited creature. Hence, they suggest the "designer" might not be God at all.

This is why the concept of "intelligent design" was quickly accepted by Myung Son Moon, and his "Unification Church." Moon considered himself to be an improvement on Christ, and ID fit his ideology. (a member of his church sits on the board of the Discovery Institute, which invented ID)

 

[Barbarian]

Anyone ever read "Cat's Cradle"?

In it he discusses a concept called Ice-nine in which a scientist manipulates a water molecule structure which changes the way environmental factors influence this specific type of water (the melting/boiling points are altered) because of the new way that these molecules "stack."

Read it. I liked Vonnegut. Sad to read his stuff, but he was scientifically literate, and always concerned with the problem of human evil. In his autobiography, I think,( "Wompeters, Foma, and Granfalloons" ) he mentions talking to a famous physicist about that premise and the physicist leaned back, and thought... "If that could happen.... " and after a while looked up and said, "no, that can't happen." So it's impossible, I guess.

 

[Vaccine]

You know people are reaching when they have to play semantics to make their point. Look, DNA is not the same as computer code unless you use the most kindergarten/ vague definition you can get. When you get away from that and actually try to directly compare DNA to computer code, you end up with problems, like how DNA is a combination of proteins where computer code is math algorithms and symbols.

Also, not that you are stretching this into an argument that RNA is a machine I'm done. At this point the connection has been made so vague that anything can be considered a machine or code.

Using a dictionary to make sense is the opposite of semantics.

 

[Milk-Drops]

Using a dictionary to make sense is the opposite of semantics.

If your argument boils down to whether or not you can make a comparison by a dictionary technicality and not based on observable research or confirmation through experimentation, then you are using a semantics argument.

Your argument hinges on how DNA and Computer coding languages are similar because both can be described as a form of code based on the most basic definition of code. My statement is, so what? That is semantics. When you actually figure out that Languages such as C, Java, and Basic are codes that are based around symbols and predetermined functions, it is no where near how DNA functions. DNA follows Chemical and biological laws where computer code follows math laws and predetermined rules set by the code monkey.

DNA is self replicating while computer code isn't. DNA is a chemical reaction, computer code is a command.

Your analogy falls apart the farther the research goes in DNA and RNA.

 

[Vaccine]

One is demonstrably artificial. One is demonstrably natural.

This isn't meant as sarcasm but to keep us on the same page and not drift into semantics.


natural language
n.
A human written or spoken language as opposed to a computer language.


http://www.thefreedictionary.com/natural+language


DNA is not a natural language. By definition DNA is an artificial language.

If it was designed by God, it would be the same in all organisms. But it's not. And the small differences sort out according to taxa, so the evidence shows that evolved, too. If it was designed, the "designer" isn't so good.

It is the same in every organism with DNA. This is known as universal genetic code, meaning every organism with DNA uses the same artificial language. This is not to be confused with an organisms genome. The design was perfect, there is a such thing as the fall. There is some very interesting research on Mitochondrial DNA. I believe mitochondrial DNA could explain the fall, death, aging, mutations.

Engineers turn to God's design.

It is disrespectful to suggest God is limited. He is the Creator. By demoting him to a "designer" (the guys who invented ID say God could just be a "space alien") one denies His omnipotence.

I wasn't suggesting God was limited. That's mixing religion and science. Creator is theology, designer is science. All ID says is we can recognize God designed life. Due to the fall DNA isn't perfect anymore. A knife is designed, that's science. Whether its used to kill or cure is theology.
Technically the guy who invented ID was William Paley 1743-1805.

http://www.thefreedictionary.com/design
























de·sign (d

-z

n

)
v. de·signed, de·sign·ing, de·signs
v.tr.
1.
a. To conceive or fashion in the mind; invent: design a good excuse for not attending the conference.
b. To formulate a plan for; devise: designed a marketing strategy for the new product.
2. To plan out in systematic, usually graphic form: design a building; design a computer program.
3. To create or contrive for a particular purpose or effect: a game designed to appeal to all ages.
4. To have as a goal or purpose; intend.
5. To create or execute in an artistic or highly skilled manner.
v.intr.
1. To make or execute plans.
2. To have a goal or purpose in mind.
3. To create designs.
n.
1.
a. A drawing or sketch.
b. A graphic representation, especially a detailed plan for construction or manufacture.
2. The purposeful or inventive arrangement of parts or details: the aerodynamic design of an automobile; furniture of simple but elegant design.
3. The art or practice of designing or making designs.
4. Something designed, especially a decorative or an artistic work.
5. An ornamental pattern. See Synonyms at figure.
6. A basic scheme or pattern that affects and controls function or development: the overall design of an epic poem.
7. A plan; a project. See Synonyms at plan.
8.
a. A reasoned purpose; an intent: It was her design to set up practice on her own as soon as she was qualified.
b. Deliberate intention: He became a photographer more by accident than by design.
9. A secretive plot or scheme. Often used in the plural: He has designs on my job.


vb
1. to work out the structure or form of (something), as by making a sketch, outline, pattern, or plans
2. to plan and make (something) artistically or skilfully
3. (tr) to form or conceive in the mind; invent
4. (tr) to intend, as for a specific purpose; plan
5. (tr) Obsolete to mark out or designate
n
1. (Fine Arts & Visual Arts / Art Terms) a plan, sketch, or preliminary drawing
2. (Fine Arts & Visual Arts / Art Terms) the arrangement or pattern of elements or features of an artistic or decorative work the design of the desk is Chippendale
3. (Fine Arts & Visual Arts / Art Terms) a finished artistic or decorative creation
4. (Fine Arts & Visual Arts / Art Terms) the art of designing
5. a plan, scheme, or project
6. an end aimed at or planned for; intention; purpose
7. (often plural; often foll by on or against) a plot or hostile scheme, often to gain possession of (something) by illegitimate means
8. a coherent or purposeful pattern, as opposed to chaos God's design appears in nature
(Philosophy)
argument from design Philosophy another name for teleological argument
[from Latin dēsignāre to mark out, describe, from de- + signāre to mark, from signum a mark, sign]
designable adj
Collins English Dictionary – Complete and Unabridged © HarperCollins Publishers 1991, 1994, 1998, 2000, 2003
de•sign (dɪˈzaɪn)

v.t.
1. to prepare the preliminary sketch or the plans for (a work to be executed): to design a new bridge.
2. to plan and fashion artistically or skillfully.
3. to intend for a definite purpose: a scholarship designed for foreign students.
4. to form or conceive in the mind; contrive; plan: The prisoner designed an intricate escape.
5. to assign in thought or intention; purpose: to design to be a veterinarian.
v.i.
6. to make drawings, preliminary sketches, or plans.
7. to plan and fashion the form and structure of an object, work of art, decorative scheme, etc.
n.
8. an outline, sketch, or scheme of something to be executed or constructed, as a work of art or a building.
9. organization or structure of formal elements in a work of art; composition.
10.
a. the combination of details or features of something executed or constructed: the design of the master bedroom.
b. a pattern or motif: the design on a bracelet.
11.
a. the art of designing.
b. the art or profession of decorative design.
12. a plan or project: a design for a new process.
13. a plot or intrigue.
14. designs, a hostile or aggressive project or scheme with evil or selfish motives: to have designs on someone's property.
15. intention; purpose; end.
[1350–1400; Middle English < Latin dēsignāre to mark out]
Random House Kernerman Webster's College Dictionary, © 2010 K Dictionaries Ltd. Copyright 2005, 1997, 1991 by Random House, Inc. All rights reserved.

 

[Vaccine]

Using a dictionary to make sense is the opposite of semantics.

If your argument boils down to whether or not you can make a comparison by a dictionary technicality and not based on observable research or confirmation through experimentation, then you are using a semantics argument.

Your argument hinges on how DNA and Computer coding languages are similar because both can be described as a form of code based on the most basic definition of code. My statement is, so what? That is semantics. When you actually figure out that Languages such as C, Java, and Basic are codes that are based around symbols and predetermined functions, it is no where near how DNA functions. DNA follows Chemical and biological laws where computer code follows math laws and predetermined rules set by the code monkey.

DNA is self replicating while computer code isn't. DNA is a chemical reaction, computer code is a command.

Your analogy falls apart the farther the research goes in DNA and RNA.

This is where the research is going.
Dr. Perez is a computer scientist. The farther the research goes, the more similarities there are with the genetic code and computer code. They even suggest the most productive research will be in computer sciences examining the genetic code.
Symbols and predetermined functions are exactly how DNA works, it's called a syntax.
CCG codes for alanine. CCATAGCACGTTACAACGTGAAGGTAA codes for insulin.
RNA converts those instructions into proteins/enzymes.
A checksum is math.
So the Universal Genetic Code Table not only maps codons to amino acids, but serves as a global checksum matrix


Human DNA is like a computer program but far, far more advanced than any software ever created. – Bill Gates, The Road Ahead, Penguin: London, Revised, 1996 p. 228

DNA can replicate itself. Technically a RAID 1 configuration is computer code copying itself, but I agree a computer can't make a copy of itself. DNA typically runs on different hardware but is an artificial language. BASIC is another artificial language. It's apples to apples. http://research.microsoft.com/en-us/projects/dna/ http://www.cybertory.org/simulators/index.html
In binary, there are 8 bits in a byte. In the genetic code there are 3 base pairs (bits) in a codon (byte).
RNA is quaternary also, U, C, G, A. 6 base pairs can map to 64 amino acids, even though there are only 20 amino acids. DNA transcribes much of the genome to RNA, but for some reason not much research has been done even though it's been known since the 1970's. From what I learned they dismissed this transcription as accidental or useless.

 

[Milk-Drops]

This is where the research is going.

No it isn't. Considering the major studies and research currently is around cancer research, epigenetics, and nano tech.

Dr. Perez is a computer scientist.

He's not a geneticist or chemist though. Also, his reserach is several years old.

The farther the research goes, the more similarities there are with the genetic code and computer code.

The only similarities you gave is a dictionary definition and one source by Perez. Not even a current one at that.

They even suggest the most productive research will be in computer sciences examining the genetic code.

Its not they, you gave one source.

Symbols and predetermined functions are exactly how DNA works, it's called a syntax.

DNA does not perform Syntax. Genes are expressed.

CCG codes for alanine.

No that is the chemical coponents of Alanine.

CCATAGCACGTTACAACGTGAAGGTAA codes for insulin.

No, that's the sequence that equals insulin.

RNA converts those instructions into proteins/enzymes.

That is its chemical function, yes.

A checksum is math.

No a check sum is a process that is explained with math.

So the Universal Genetic Code Table not only maps codons to amino acids, but serves as a global checksum matrix

I actually read the article you sourced, well I had to track it down first. Perez says its similar to a matrix. He alludes to it being similar, but not exactly the same.

]Human DNA is like a computer program but far, far more advanced than any software ever created – Bill Gates,

An article where Gates explains how he sees similarities. He is not a geneticist, this is also not a scientific article, but an opinion piece.

 

[Barbarian]

This isn't meant as sarcasm but to keep us on the same page and not drift into semantics.


natural language
n.
A human written or spoken language as opposed to a computer language.


http://www.thefreedictionary.com/natural+language

Dictionaries will often lead you astray, if you use them for scientific definitions. But your definition does not say that DNA is an artificial language. It identifies two kinds of languages; human languages which is says is "natural" (even though humans make them) and computer languages. Odd to think of things man makes as "natural", and things nature makes as "artificial."

DNA is not a natural language. By definition DNA is an artificial language.

Not by the definition you offered. DNA is not a computer language, and of course, it doesn't define computer languages as "artificial" anyway.

Barbarian observes:
If it was designed by God, it would be the same in all organisms. But it's not. And the small differences sort out according to taxa, so the evidence shows that evolved, too. If it was designed, the "designer" isn't so good.

It is the same in every organism with DNA.

No, it isn't.
While slight variations on the standard code had been predicted earlier,[30] none were discovered until 1979, when researchers studying human mitochondrial genes discovered they used an alternative code. Many slight variants have been discovered since then,[31] including various alternative mitochondrial codes,[32] and small variants such as translation of the codon UGA as tryptophan in Mycoplasma species, and translation of CUG as a serine rather than a leucine in yeasts of the "CTG clade" (Candida albicans is member of this group).
http://en.wikipedia.org/wiki/Genetic_code

The design was perfect, there is a such thing as the fall.

If the design was perfect, it wouldn't have variations. "The fall" should not be used as a magic wand to wave away any difficulties.

There is some very interesting research on Mitochondrial DNA. I believe mitochondrial DNA could explain the fall, death, aging, mutations.

It's just bacterial DNA. Mitochondria are bacterial endosymbionts.

Engineers turn to God's design.

Barbarian observes:
It is disrespectful to suggest God is limited. He is the Creator. By demoting him to a "designer" (the guys who invented ID say God could just be a "space alien") one denies His omnipotence.

I wasn't suggesting God was limited.

Demoting Him to designer does just that.

That's mixing religion and science. Creator is theology, designer is science.

Nope. Just religion, according to the guys who invented it. They claim the purpose of it is to convince people God made everything. I think they'd do better using the approach Jesus used.

All ID says is we can recognize God designed life.

It's called "natural theology." Religion.

Due to the fall DNA isn't perfect anymore.

Sorry, just a catchall defense against reason. Not convincing. You could justify anything by saying "the fall did it."